However, if you use the Perturb-seq backbone from Jonathan Weissman's lab ( Adamson et al. Then, your sgRNA scaffold sequence will be:ĥ'- GUUUUA GA GCUAGAAA UAGC AAGU UAAAAUAA GGCUAGUCCGU UAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU -3'Īnd your final sgRNA transcripts will be like this: Genome-wide Mouse Lentiviral CRISPR gRNA Library v1 from Kosuke Yusa's lab, Koike-Yusa et al., 2014, addgene #50946ĬROP-seq from Christoph Bock's lab, Datlinger et al., 2017, addgene #86708 GeCKOv2 from Feng Zhang's lab, Sanjana et al., 2014, addgene #52961 The exact sgRNA scaffold sequences vary among them. There are a few different vector backbones for CRISPR screening. Your sgRNA is often driven and transcribed by a U6 promoter from a vector backbone. Your sgRNA structure is like this (picture taken from Briner et al. The sgRNA has two parts: a 17-20 nt so-called Protospacer (or just Spacer) that determines the specificity of the target, followed by a constant region called sgRNA scaffold that forms different loop structures. I'm not an expert on CRISPR, so please correct me if I am wrong. At least I did not understand it when I first saw the kit. I feel it is necessary to explain a bit more about the CRISPR screening part. The antibody part is relatively easy to do and understand. Feature Barcoding allows you to profile surface protein abundance by using oligo-conjugated antibodies (basically CITE-seq) and CRISPR screening by capture sgRNA on top of gene expression. I copied this file and renamed it to this repository. The path is cellranger-6.0.2/lib/python/cellranger/barcodes/translation/ ( not to be confused with the file of the exact the same name in the directory one level above). This file can be found from the Cellrange software. You need a mapping file to tell you the mapping between RNA cell barcodes and Feature cell barcodes. NOTE: the cell barcodes used for RNA and Feature are different in the same drop. Each bead has three types of oligos, one for gene expression ( click here to see how it works) and the other two for feature barcoding. In the V3 chemistry, the oligo beads are modifidied to support feature barcoding.

10x Chromium Single Cell 3' V3 Feature Barcoding 10x Chromium Single Cell 3' V3 with Feature Barcoding

10x chromium i7 sample index